The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera.
نویسندگان
چکیده
The nucleotide sequences of 5S rRNA from two red algae, Gracilaria compressa and Porphyra tenera have been determined. The two 5S rRNAs are fairly dissimilar to each other in their sequences (65% identity), although they are both composed of 121 nucleotides. Their secondary structures are generally of the eukaryotic with a prokaryotic characteristic. Judged from the 5S rRNA sequence data, the red algae are phylogenically distinct from green and brown algae, and they, Porphyra in particular, are evolutionally most ancient among the eukaryotes of which 5S rRNA sequence has been determined.
منابع مشابه
Sequence and secondary structure of Porphyra umbilicalis 5S rRNA. Relevance for the evolutionary origin of red algae.
This pattern can be explained by assuming that the ancestral, eukaryotic 5S rRNA shared the first two features with the archaebacterlal and eubacterial 5S rRNAs, and that these were altered in the eukaryotic branch of evolution only after the divergence of the red algae, the latter conserving these ancestral features until the present time. As such, the study of 5S rRNA secondary structure cons...
متن کاملMinerals and Heavy Metal Present in the Selected Red Seaweeds of South Coast Region of Tamilnadu
The main aim of the study was to evaluate the various minerall and heavy metals parameters of seaweeds present in the south coastal line. The five red seaweeds namely Acanthophora deliei, Scinaia furcellata, Porphyra tenera, Gracilaria verucosa and Hypnea species were collected from the Pamban, South east coast India. These samples were analyzed for its mineral contents such as sodium, potassiu...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملNitrogen and phosphorous budgets for integrated culture of Litopenaeus vannamei with red sea algae Gracilaria corticata under zero water exchange system
Abstract In this study, a 2×3 factorial design with two levels of shrimp density (25 and 50 shrimp per m-2) and three levels of red algae density (0, 200 and 400g per m-2) was applied to calculate nitrogen and phosphorous budgets in integrated culture of Litopenaeus vannamei with Gracilaria corticata during 45 days under zero water exchange system. Juvenile of L.vannamei (5.82 ± 0.11 g...
متن کاملNucleotide sequence of cytoplasmic 5S rRNA from a eukaryotic thermophilic unicellular alga, Cyanidium caldarium.
From a total RNA extract of Cyanidium caldarium (Cca) cells we isolated, by the use of polyacrylamide gel electrophoresis under denaturing conditions, cytoplasmic 5S rRNA and determined its primary and possible secondary structure (Figure 1). The Cca 5S rRNA (i) is 124 nt long, (ii) harbors, at the expected positions, both internal transcription signals characteristic of this class of RNA polym...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Nucleic acids research
دوره 11 15 شماره
صفحات -
تاریخ انتشار 1983